Wednesday, October 2, 2019

Film Analysis: South of the Border

Film Analysis: South of the Border South of the border- Film Analysis Social media has been a great influencer in this present reality. This current generation has been depending so much on the social media to the extent of believing all the things they have been reporting. Recently, a certain new report of a local station about the ‘mysterious disease’ immediately got the attention of the people. The said province in which the disease was found is Pangasinan. After a few moments, a hashtag trended, people were tremendously scared concluding that a prediction was fulfilled. This is an example of how mass media has fed informations to its audiences. Later on, they found out that it was a skin disease which can be cured. Facebook, twitter and instagram are just some of the social networking sites that communicate news and most of the Filipinos are subscribed to them. Imagine how fast these news travel just by clicking the post or tweet button. That button has been an empowerment for an ordinary person to tell the world what is happening. Soc ial media, specifically, the current news programs are the source of our knowledge regarding the current economic status of our country, current social issues which affect our country and other aspects related to the Philippines. A primary reason why Filipinos are really into social media is that they want to be updated and be a part of the hot issues. The film â€Å"South of the Border† exhibits how the mass media influenced the minds of the people. At the start of the film, newscasters are telling the audiences that a certain dictator chews coca everyday. They were pronouncing it like cocoa and considered it as a joke. They said that the leader was a drug addict. Hugo Chavez is the president of Venezuela. He won the 1997 presidential race to a Ms. Universe, in the film the race was coined the Beauty and the Beast. Even though he was imprisoned, the Venezuelan people still believed and elected for him. He aims to fight against corruption and economic inequity. He did what he can to fulfill his promises to the people of Venezuela. However, the US government announced that they are concerned about Venezuela and controlled the media, mostly private media. A businessman in Venezuela is believed to be fit for the position. Chavez claimed that the US government has 3 motives. One of which is oil. Second and third are Saddam and I raq respectively. As shown in the film, Venezuela is the third largest supplier of petroleum. A coup for Chavez was formed. The media and other known printing press have been communicating false information about Chavez. Many people died due to numerous killings. Chavez was captured and imprisoned. A new leader is seated but it is believed that he is a puppet of the US government. The prices of oil and petroleum products, as described in the film, dramatically went down. Hugo Chavez went back to his position due to the insistent public demand of his supporters even the military. The newspapers, news stations and other well-known media companies apologized for the false statements they released. The director, also the narrator and interviewer, Oliver Stone visited other countries in the Latin America. He went to Bolivia and met the president, Evo Morales. Coca leaves is different from cocaine, contrary to what the US citizens believe. Coca will be a drug if it is mixed with other chemicals. Oliver Stone even chewed a few leaves of coca. This product of Bolivia is like a stimulant similar to caffeine. Next stop is Argentina with Cristina Kirchner. In Argentina, there have been five presidents who ruled in just two weeks. She is also the only female leader among the presidents of the Latin America. Her husband, Nestor Kirchner is the ex-president of the Argentina. She shared that unemployment and poverty in Argentina is spread all over the country. his husband also shared that Bush claims that war is the answer to revitalize the economy. Fernando Lugo in Paraguay was also interviewed by Stone. He is a bishop who entered the politics. Another country that he visited is Brazil. Lula da Silva is the president of Brazil. What he wants is for them to be treated equally. He shared that Argentina and Brazil have been trading in their own currency. He also told Stone that all their debts are paid off. The second to the last country Stone visited is the Cuba ruled by Raà ºl Castro. And last but certainly not the least, Ecuador. Like what Silva said, Rafael Correa also aspires for equality. He is worried about the military base of the US in Ecuador. It is quite amusing that a filmmaker would have the courage to do things like this. He aimed to let the people know what kind of leaders these people are. Who are they, really? Are they really dictators? Are our perceptions about them true? What is the current status of each government? Stone showed their point of views regarding the media perceptions about them. The film exposes several issues regarding the conflict between Bush and the Latin American presidents. Hugo Chavez is greatly emphasized on the film. Those presidents in the south are friends. Kirchner even showed a picture of them during an inauguration. This film basically emphasizes the media’s role to what happened to these countries and their presidents. Mass media has been showing and telling a lot of audiences about what is happening in these countries. Graber (2009) claimed that mass media are â€Å"powerful guardians† to people because Americans believe that media should inform them about the current h appenings in the government. During the coup of Chavez, mass media is the main influencer to the behavior of the Venezuelans. They have been feeding the people’s minds with false information about Chavez. The New York Times even apologized for their statement during the coup. Stone described these events as ‘deeply troubling’. At one point, the US government hosted the people involved in the coup, and then they were not involved in the coup. They also stated that there was a resignation not a coup. This, for me, is entirely confusing. The first issue introduced is about the use of drugs by Chavez. The reporters told the audiences how the â€Å"dictator† chewed coca leaves from Bolivia. They referred to him as a drug addict. This is a case in which the media showed how they communicated false information. As I have mentioned in the summary above, coca is just a stimulant like caffeine. They also called Morales as â€Å"Evil Morales† during news segments or frames. These informations are fed to the minds of people. Eventually, these affect the views of people. For the lack of decipher, people will believe what newscasters say, whether truth or not. Chavez in our country is somehow like our late president and now a mayor of Manila, Joseph Estrada. He captured the minds of the people in his presidency. With a slogan of ‘Erap para sa masa’, poor people developed the like for him. They loved him for being concern with the poor. He gave them hope. But after being impeached on the second People Power Revolution, he still won the mayoral election in Manila. Why is this happening? Are we even looking back in the past? I think these are because of our power to speak; the freedom we have empowers us to create our own version of the truth. But this is absurd; each and every one of us deserves and has the right to know the truth, the real truth. We need to decipher whether the media are telling the truth or they are hiding something from us. Another issue present in the film was about the global capitalism. As stated by Robinson (2008), â€Å"The US state is the key instrument of the global capitalist system reproducing, or seeking to reproduce, the global capitalist system and defend the interests of global capital over national capital, and over the globally repressed and exploited sectors and those that would oppose the global capital system† (p. 9). The price of petroleum in Venezuela is relatively high during the time of Chavez but went down after he was imprisoned. This is the primary motive why they hated Chavez. The Bush administration wanted the oil residue in Venezuela since it is a major source of some of their refineries. The lowering of prices in Venezuela will give way to global capitalists. They will import low prices for petroleum which is definitely good for them, obviously. Another controversy is in Bolivia wherein they prevent people from getting water from rain. The water prices are expensive a nd the monopoly of water is getting concerned about people getting water for free. These are just some of the examples of the growing capitalism in this world. We are surrounded with capitalists aiming for the betterment of their business, some, not considering the fact about poverty and other social issues. In the Philippines, Meralco and Maynilad are some examples of monopolists. Recently, there is an issue regarding the increase of prices in the power supply. Many people are complaining about the current increase. Capitalists’ main goal is to have profits and to increase their wealth. The president of Argentina, Kirchner also the former first lady, is the only female person interviewed among the Southern American continent. She claimed that women are always asked about their clothes, jewelries and other things but men are never asked about the same things. Well, media is one of the reasons why we have this notion about women. Sometimes, they show unrealistic and wrong view of women in the society. Women are always described and shown as fashionable, bossy, pushy and extravagant. Men are never like that. In sociology, this is a feminist view. In this certain part inequality arises. Another reason is that maybe because we live in a patriarchal type of community. This gender inequality must be put to a stop. As a woman, this inequality reflects the current perception of people on women. Social media and mass media itself is pervasive enough to affect and influenced the views of people regarding women and their function in the society. The president of Brazil told Stone in his interview that they were worthless; Americans are worthy same with the Europeans but not them. The Marxist view of Sociology shows that there are two classes the oppressed and the oppressor. In this case the oppressed is the Latin America. There is inequality between them. Lula just wants to be treated equally as the United States. There is a growing gap between the US government and the Latin American government. As I view the role of social media or mass media to influencing the views of people to the presidents of the South America, I wondered if the mass media in our country behaves like them. Are our local networks and print media controlled by our government? Are they somehow feeding us false statements regarding the social issues? Do they have biases on the social issues present in this country? These questions are running on my mind right now. According to Gitlin (2003), people are pressed to depend on media too much to bear with the change in this world. My fellow Filipinos are consistently watching news, listening to radio programs and opening their social networking sites accounts. Due to that, they are being updated every hour of the day. The media always create a notion about everything. This information is being fed to us and then creates a so-called truth. The media can also fool and confuse our minds just by showing us ads and commercials. We are now trapped in a world which is shaped by the media. And we are living in a world full of lies, though I am not saying that all that we know are lies. But generally speaking, the media has contributed a lot of benchmarks and notions in our world. They can manipulate our minds. You can fool some of the people all of the time or all of the people part of the time, but you cant fool all of the people all of the time. -Fidel Castro. References: Gitlin, T. (2003). The Whole World is Watching: Mass Media in the Making Unmaking of the New Left. California, United States of America: University of California Press. Graber, D. A. (2009). Mass Media and American Politics (8th ed.). United States of America: SAGE. (Original work published 1980). Haris III, W. E. (2010, October 6). South of the border documentary film review. Retrieved from http://axisoflogic.com/artman/publish/Article_61299.shtml Reuters (2007, October 28). Fidel Castro pokes fun at George W. Bush. Retrieved from http://www.reuters.com/article/2007/10/28/us-cuba-castro-idUSN2843263920071028 Robinson, W. (2008). Understanding global capitalism. The development round table series, 1-26.

The Progressive Era: Conflicting Viewpoints Essay -- Sociology History

The Progressive Era: Conflicting Viewpoints Works Cited Missing Two people witnessing the same event can have very different views on it depending on their information and perspective. The presentation of history also changes depending on the resources and prior prejudices and personal views of the historian. Four historian’s interpretations on the Progressive Era and Progressivism were reviewed to determine whether their arguments and use of evidence were sound. Also, the particular known views of the historian were occasionally taken into account. Each of these works has its own particular view on the Progressive Era and its importance in history. In The Age of Reform, Richard Hofstadter reviews both the Populist and Progressive movements from a psychological standpoint. He maintains that both were groups, Populist farmers and Progressive long- established wealthy professionals, known as mugwumps, both of which formerly had had much power and influence in the United States and were being overshadowed by the growing importance of cities and the nouveau riche, respectively. Hofstadter’s main arguments are taken from the novels, magazines, poetry, other literature, fiction and popular myths that abounded in the two groups. Hofstadter maintains that these two groups were created because the industrialization of the United States and the rise of cities and big business had resulted in a status revolution, and the Populist and Progressive movements were just attempts to retain and regain position by the farmers and mugwumps. Populism, however, was a rural movement, while Progressivism took Populism and turned it into a la rge, national movement. According to Hofstadter, the Populist movement was created mainly because... ... least believable. Although he does make some interesting psychological hypotheses, his contentions are not backed up by few solid facts, and rest almost entirely on a selective few pieces of literature, almost all of which show an extreme slant. Filene, who presents perhaps the more radical view of the progressive movement, the idea that the movement never in fact existed, uses sound evidence and statistics to support his arguments. Although he took perhaps the most radical stand on Progressivism, his arguments were the most persuasive, due to logical presentation and ample foundations on facts. Both McCormick and Baker focused on one aspect of Progressivism, McCormick on the corruption of government by private businesses, and Baker on the women’s movement. Both historians based their arguments on fact, and used rational reasoning to come to their conclusions.

Tuesday, October 1, 2019

Cyber-terrorism Essay -- cyber attacks, 2015

"It is now clear that cyber threat is one of the most serious economic and national security challenges we face as a nation," President Obama has said in one of his addresses to the nation. He would go on the say that "We know that cyber intruders have probed our electrical grid, and that in other countries cyber attacks have plunged entire cities into darkness." (Net Security.org, 2009) When the president of the United States puts this much emphasis into a subject it shows how important it is and how big of an impact it could have on the nation. The United States is very dependent on digital networks due to the fact that almost everything is controlled by computers. Terrorist organizations and hostile countries are aware of this and an attack on our networks could be crippling to our economy. It would bring the most powerful and influential nation to a standstill. This is why president Obama has expressed the need for increased security measures because a cyber war is a reality tha t could happen soon that we must be prepared for. When a person thinks of the different types of warfare they would probably think of the more common types seen in the past wars like guerilla warfare, chemical warfare, and biological warfare. But in the present day and age a new warfare has emerged. It is the cyber warfare. This type of warfare is when an outside power may chose to attack the network or power grid with means of harmful intent. An example of this can be seen when hackers released a series of cyber attacks on Brazil’s power grid and left cities and parts of the country powerless for up to a few days. In result to this, Brazil lost millions upon millions of dollars and its economy was at a standstill. An incident that happened to the United States that helped make the security of networks front and center was in 2007 when the theft of terabytes of information was taken from the Department of Defense, The Department of State, the Department of Commerce, and the Department of Energy and Nasa because of a breach in by a foreign power. This followed by another intrusion of the CENTCOM network which is used by the Department of Defense to relay information for actions in the wars America is currently in. This attack was believed to be a backdoor attack through corrupted memory sticks and thumbnail drives. Foreign powers that staged this attack were able to see and in... ...f the Center for Strategic and International Studies summed up the United States and its stance on cyber wars as this: "We have, at best, a few years to get our defenses in order, to build robustness and resiliency into networks and critical infrastructure, and to modernize our laws to allow for adequate security. Our current defenses are inadequate to repel the attacks of a sophisticated opponent. The United States is far more dependent on digital networks than its opponents and this asymmetric vulnerability means that the United States would come out worse in any cyber exchange." (Net Security.org, 2009) Works Cited cbsnews.com. (2009, November 8). Cyber War: Sabotaging the System. Retrieved February 11, 2010, from 60 Minutes: http://www.cbsnews.com/stories/2009/11/06/60minutes/main5555565.shtml Net Security.org. (2009, November 09). Cyber war is coming, the impact could be huge. Retrieved February 11, 2010, from Help Net Security: http://www.net-security.org/secworld.php?id=8484 Net Security.org. (2009, October 27). Serious cyber attacks on the horizon. Retrieved February 11, 2010, from Help Net Security: http://www.net-security.org/secworld.php?id=8439

A Modern Anachronism

Authors have their own unique style to develop different tones and themes, and there are countless ways each author conveys his or her theme in the story. Kurt Vonnegut is an esteemed author of many well-known novels. He is also known for his collection of short stories known as Welcome to the Monkey House. One of the short stories called â€Å"All the King's Horses† displays a perfect setting of suspense, and how the effects of war erode soldiers and their families. To do this, Vonnegut uses a satirical tone with hints of unusual playful expressions; by doing so, he lets readers know that many sacrifices are at times necessary in order to protect loved ones, just Vonnegut's character Pi Ying says, â€Å"a chess game can very rarely be won . . . without sacrifices. The theme is that people shouldn't rely on their own individual talents and social status to get themselves past obstacles in the path to their goal. Kurt Vonnegut creates his theme with the aid of the satirical tone in the story â€Å"All the King's Horses†. Vonnegut is implying that there needs to be a point where people use their own unique abilities to enhance what they do for a living. The reason Vonnegut used a game of chess, instead a game of checkers, is for the immense magnitude of possible choices a person can make in the game of life. Every person has his or hers own style, making it so each player in the Miguel 2 game of chess must learn quickly the style of the other person. This concept of adapting rapidly to the opponent is the basic theme Vonnegut clearly wants to convey in the story. Characters in Vonnegut's short stories have a unique role, especially in his story â€Å"All the King's Horses†. There are two main characters that develop the tone of sarcasm and cynicism. Colonel Kelly and Pi Ying are two leaders of their own respective groups armed to play a game of chess, which symbolizes two armies in battle. Although Pi Ying uses life-sized chess pieces, Colonel Kelly's family and the soldiers under his command must listen to the colonel's orders like pawns. Pi Ying's second in command is Major Barzov, who makes a point, † He'll learn to be a pawn yet . . . It's and Oriental skill Americans could do well to learn for the days ahead, eh? † (99). This quote adds a satirical tone as Kelly is continually losing soldiers literally. Vonnegut chose this tone because he wanted to criticize the lack of respect some people have towards international cultures or at least the misunderstanding. All the King's Horses† brings the concept of reality to the reader's attention. Vonnegut wants to make sure his readers of future generations don't take family and their prized possessions for granted. Work is a must as technology advances to engulf the â€Å"archaic† ways of doing tasks. But some tasks require the archaic work ethic in order to master the task such as in the classic game of chess. Like Colonel Kelly and Pi Ying, people must work efficiently to earn possessions and a loving family.

Monday, September 30, 2019

Ways Of Preventing Maternal Death Health And Social Care Essay

A maternal decease is â€Å" the decease of adult females while pregnant or within 42 yearss of expiration of gestation, irrespective of the continuance or site of the gestation, from any cause related to or aggravated by gestation or its direction, but non from inadvertent causes † . [ 1 ] Many people die from pregnancy-related causes and over 90 % of them occur in developing or under-developed states. Reducing maternal mortality by 75 % by 2015 has been one of the United Nations Millennium ends. [ 2 ] The causes of maternal decease vary from infection to gestational high blood pressure to complications of insecure or unhygienic abortions and many more. Many developing states lack equal wellness attention and household planning. Basic exigency obstetric intercessions, indispensable household planning methods, adequate wellness attention are far from the range of a pregnant adult female in a underdeveloped state. Forty-five per centum of postnatal deceases go on within the fir st twenty-four hours itself and little more than 60 % occur during the first hebdomad. Of the estimated 211 million gestations, 46 million consequences in induced abortions, more than 50 % of these abortions are insecure and do 68,000 deceases yearly. [ 3 ] The International Safe Motherhood Conference was held in Kenya in 1987. It brought to the attending of the universe communities of the annihilating effects of lifting maternal mortality rates in developing states and officially established the Safe Motherhood Initiative. The primary purpose was to diminish maternal mortality by 50 % by 2000, besides conveying to the attending of the planetary community the quandary of pregnant adult females. In the beginning patrons, United Nations ( UN ) bureaus and authoritiess of states focused on the improvement of prenatal attention, preparation of birth attenders, since these schemes failed, the universe reaffirmed its committedness in 2000 and stipulated a decrease in maternal mortality of 75 % by 2015. [ 2 ] Target 5.A: Reduce by three quarters, between 1990 and 2015, the maternal mortality ratio 5.1 Maternal mortality ratio 5.2 Proportion of births attended by skilled wellness forces The lending factors to maternal mortality in most developing states circulate around 3 holds. [ 4 ] The first hold would be that of the female parent, the household or the community who fail to acknowledge an at hand job or life -threatening status. [ 4 ] Many deceases occur within first 24 hour of postpartum. In most rural communities births occur at place with unskilled attenders who do non hold the accomplishment to find and forestall serious results and medical cognition to name and move on their complications. The 2nd hold would is the that in accessing a wellness attention installation. [ 4 ] It can be either due to hapless route conditions, deficiency of equal transit or even due to locations of these installations. The 3rd hold is the health- attention installation itself. [ 4 ] Resource -poor states with their fragile wellness attention systems and installations which do non hold much needed engineering or services necessary to supply critical attention. Due to inefficient i ntervention, and deficiency of accomplishment and supplies many adult females die each twelvemonth. CONCEPTS AND PROGRESS The highest Numberss of births per twelvemonth ( 27 million ) in the universe takes topographic point in India. [ 4 ] It has a maternal mortality of about 300-500 per 100,000 births and about 150000 maternal deceases take topographic point every twelvemonth in India, which is about 20 % of planetary maternal decease. [ 5,6 ] The calamity is these deceases are that they are mostly preventable. Therefore India ‘s proficiency in the decrease of maternal wellness is critical to the planetary accomplishment of Millennium Development Goal 5 ( MDG 5 ) . Based on grounds, intercessions for cut downing maternal mortality should strategically aim the chief causes of maternal decease. EMERGENCY OBESTERTIC CARE ( EMOC ) EMOC is one of the most cost effectual schemes implemented to cut down maternal deceases. [ 7 ] As it has been found that many maternal deceases occur due to obstetric exigencies that erupt all of a sudden at the oncoming of labour or instantly after. Availability of EMOC services in India is extremely lacking due to miss of focal point and limited direction capacity. EMOC was non successfully implemented and the authorities does non supervise how they function. The official attack is to advance institutional bringings and develop community wellness attention. It is doubted that this scheme will hold any consequence as bulk of bringings in India take topographic point at places in distant small towns. In 1992 India launched its first Child Survival and Safe Motherhood plan followed by Reproductive and Child wellness in 1997. [ 8 ] The former plan aimed at advancing medical aid at bringing, proviso of sterile bringing kits and beef uping referral units that deal with high hazard and o bstetric exigencies through Emergency obstetric attention ( EOC ) .The latter plan aimed at direction of unwanted gestations and one of their chief purposes was to supply quality integrated and sustainable primary wellness attention services to adult females of generative age group. [ 8 ] Recently The National Rural Health Mission was launched in 2005 that aimed to specifically make the households populating below the poorness line with much required wellness services. Besides, new reforms which aimed at developing small town wellness attention workers and advancing institutional bringings were to be patronized. [ 9 ] Under the NHRM a new strategy known as `janani express ‘ was launched in a province called Madhya Pradesh to supply nonstop free transit installations to pregnant adult females to wellness attention centres and infirmaries in rural parts thereby guaranting best possible attention when pre and post- bringing exigency conditions would originate both for the female parent and the baby involved. [ 10 ] ANTENATAL, INTRA NATAL AND POSTNATAL CARE The consensus among international organisations and India is that maternal quality attention is required throughout a adult females ‘s generative life. From planing inducements to increase results during from ante-partum period through intra-partum to postpartum period. Promoting maternal and child wellness has been an built-in of the Government of India. Safe maternity and Child wellness services were incorporated into the Reproductive and Child wellness plan ( Ministry of wellness and household public assistance 1997,1998b ) .The of import components of these plans include supplying prenatal attention, which includes at least 3 prenatal attention visits, Fe prophylaxis for pregnant and breastfeeding female parents, observing and handling anaemia in female parents, two doses of lockjaw toxoid vaccinum and direction and referral of bad gestations. Encouragement of institutional bringings or place bringings assisted by trained wellness forces was advocated. Supplying postpartum attention including three postpartum visits. Assorted intercessions such as attempts to turn to and handle postnatal bleeding and infections by supplying Pitocins and antibiotics in wellness attention installations have been implemented. Besides manual remotion of placenta, blood transfusion, hysterectomy processs, intervention of eclampsia with antiepileptics h ave been addressed. [ 11 ] Midwife In pre independent India, many efforts were made for bettering safe obstetrics accomplishments. From puting up an Advisory commission on Maternal mortality in India to constitutions of a `dai ‘s † ( obstetrics ) school in Amristar in 1980. However, the focal point on safe maternity and skilled aid shifted when India adopted new policies. In 1960, to supply indispensable maternal and kid wellness services, India created a model of two twelvemonth trained rural accoucheuse ( ANMs ) .Their appellation as â€Å" auxillairy † unluckily threatened their position and map as accoucheuses though they well fitted the definition of a skilled birth attender. Majority of the ANM ‘s lacked the needed cognition and accomplishments to supply maternal attention and support. Under intense authorities force per unit area, The INC ( Indian nursing council ) revised the ANM preparation class, and the function of ANM changed from a maternal wellness attention worker to household p lanning and immunisation ( 1966 ) .Abolishment of institution-based accoucheuses and replacing them with general nurse accoucheuses led to annulment of these preparation plans that were entirely set up for obstetrics. These general nurses were alternated between sections of the infirmary and are besides automatically registered as accoucheuses. Since most births in India are domiciliary bringings, the demand to supply skilled birth attending at community degree is high. [ 12 ] Besides, in certain countries such as the province of Tamil Nadu, hard currency inducements were provided in a strategy aiming adult females under poorness line known as the Dr. Muthulakshmi Reddy Scheme to assist adult females back up themselves during gestation period, childbearing and postal natal period through nutrition and equal conveyance. [ 13 ] HEALTH CARE SYSTEM AND POLICIES IN INDIA Improved health-care system ensures decrease of maternal mortality, thereby bettering the general wellness of a state. Measuring and measuring the advancement a state makes poses a challenge. The authorities of India has been implementing assorted jobs to undertake these issues. In 1997, the Reproductive and Child wellness ( RCH ) plan was launched aimed at universalising immunisation, prenatal attention and skilled attending during bringing. Reduction maternal mortality was an of import end RCH-2 that was launched in 2005. Incentives were given to staff to promote round the clock OBs services at wellness attention installations. [ 11 ] The National Rural wellness mission ( NRHM ) which was formed in 2005 aimed at beef uping wellness attention systems in rural countries. Under NRHM, the Janani Suraksha Yojana ( JSY ) plan, the pregnancy benefit strategy, was introduced in 2005, hard currency aid was provided to adult females who deliver in wellness installations. [ 9 ] NGO ‘s s uch as SAHAYOG are working to advance maternal wellness through partnerships with other organisations to increase community adult females ‘s entree to maternal wellness services, besides to advance adult females generative rights. To carry through these aims the Maternal Health and Right plans uses human rights-based attacks through instance certification, runs research, monitoring, protagonism and policy shapers, and media. This plan seeks to understand worlds of maternal wellness. They work at province degree with the aid of Women ‘s Health Rights Forum ( Mahila Swasthya Adhikar Manch ) in raising consciousness of maternal wellness services of rural adult females, at the national degree in edifice alliances around interest holders i.e. adult females, wellness service suppliers and policy shapers for bettering maternal wellness and at the international degree by join forcesing among safe maternity and human rights organisations from around the universe. [ 14 ] Target 5.B: Achieve, by 2015, cosmopolitan entree to reproductive wellness 5.3 Contraceptive prevalence ratey 5.4 Adolescent birth rate 5.5 Antenatal attention coverage ( at least one visit and at least four visits ) 5.6 Unmet demand for household planning Over the decennaries there has been a significant addition in the demand for consciousness of generative wellness in India to control the of all time turning birth rate. In 1951, The Family Welfare Program was set up with an aim of cut downing birth rate and doing it consistent with the demand of national economic system. Besides to confirm the authorities committedness towards the citizens availing generative wellness attention services. Due to increase in fiscal investings of the authorities, assorted plans covering with immunisation, gestation, bringing and preventative and healing wellness has been provided. In order to cut down the birth rate, rubbers and unwritten preventives pills were provided free or sold at subsidised rates. Intrauterine devices such as CU-T were supplied free of cost to all the provinces. [ 15 ] A strategy known as the Sterilization beds strategy was introduced in 1964 in order to supply installations like tubectomy operations in wellness attention centres when instances such as these could non be admitted due to miss of beds. Besides No-Scalpel Vasectomy Project is being implemented to assist work forces follow male sterilisation and therefore implementing male engagement in the race to restrict of all time turning birth rates. [ 16 ] The Integrated Child Development Scheme ( 1975 ) provides supplement nutrition, wellness attention medical examinations before and after bringing and wellness and nutrition instruction to pregnant adult females and chest eating female parents. [ 17 ] Many strategies were introduced with purposes of puting wellness stations in slums countries and supplying referral services affecting distribution of preventives. The 90 ‘s witnessed a alteration in the quality of household planning services, use of contraceptive method etc. During the fifth five twelvemonth program, the Indian authorities designed schemes to advance and actuate household be aftering methods with the aid of an advertisement bureaus of India which was immense measure in a conservative society like India. At the start of the millenary, India aimed at cut downing the birthrate rate by presenting inducements such as providing preventives. India claims to be the first state in the universe to establish a countrywide plan by providing prophylactic devices to restrict the population growing. Many ends from bettering poorness, detaining matrimony, honoring Panchayats and Zilla Parshads for their function in universalising the little household norm, advancing literacy plans, accomplishing decrease birth rates were brought approximately. Besides hard currency inducements were provided to female parents who have their first kid after 19 year of age, honoring twosomes who come below the poorness line if they decide to get married after making legal nubile age of 21. Decision India has shown singular advancement in cut downing maternal mortality by presenting clever alterations within the bing model of organisational set-up, resources and restraints. Overshadowing political precedence and constitutional policies of province authoritiess to cut down maternal mortality has been a steering force. India is traveling easy towards accomplishing mark of MDG 5, but to accomplish them within the stipulated clip bound, it will necessitate to speed up gait of intercessions, despite stray illustrations of advancement, national and planetary attending to maternal and child wellness. REFRENCES [ 1 ] The International Classification of Diseases, Injuries and Causes of Death – 9th alteration ( ICD9 ) [ 2 ] World Health Organization ( WHO ) , authorsyThe World Health Report 2005: Make Every Mother and Child Count.yGeneva, Switzerland: WHO ; 2005. [ Accessed June 25, 2008 ] .http: //www.who.int/whr/2005/whr2005_en.pdf. [ 3 ] 1.yUnited Nations, authors.yUN Millennium Development Goals Web site.y [ Accessed June 25, 2008 ] .http: //www.un.org/millenniumgoals/ [ 4 ] 3.yMaternal United Nations Population Fund ( UNFPA ) , authorsyMaternal Mortality Update 2002: A Focus on Emergency Obstetric Care.yNew York: UNFPA ; 2003. [ Accessed July 7, 2008 ] .http: //www.unfpa.org/upload/lib_pub_file/201_filename_mmupdate-2002.pdf. [ 5 ] Maternal mortality in India: 1997-2003. Tendencies, causes and hazard factors. New Delhi: Registrar General ; 2006. [ 6 ] National Family Health Survey ( NFHS-2 ) Key Findings. International Institute for Population Sciences ; 1998-99. p.12. . [ 7 ] Maine D. Safe maternity plans: options and issues. Columbia University ; 1993. [ 8 ] Ved RR, Dua AS. Review of adult females and kids ‘s wellness in India: focal point on safe maternity [ Background paper for â€Å" Burden of Disease in India † ] . National Commission on Macroeconomics and Health Publication, India ; 2005. [ 9 ] National Rural Health Mission model for Execution 2005 – 2010. New Delhi: Ministry of Health and Family Welfare, Government of India ; 2005.yy [ 10 ] Janani Express Yojana: Madhya Pradesh, hypertext transfer protocol: //india.gov.in/citizen/health/viewscheme.php? schemeid=2055 [ 11 ] The National Child Survival and Safe Motherhood Programme. Ministry of Health and Family Welfare, Government of India, 1992.yy yy [ 12 ] y Mavalankar D, Vora K. Changing function of subsidiary nurse accoucheuse in India. [ 13 ] World Health Organization Regional Office for South East Asia, 2009. Safer Pregnancy in Tamil Nadu: From vision to Reality 2009 [ 14 ] SAHAYOG, hypertext transfer protocol: //www.sahayogindia.org/ [ 15 ] Family Welfare Programme in India, hypertext transfer protocol: //mohfw.nic.in/dofw % 20website/family % 20welfare % 20programme/intro.htm [ 16 ] Family Welfare Programme in India, No-Scalpel Vasectomy plan, hypertext transfer protocol: //mohfw.nic.in/dofw % 20website/family % 20welfare % 20programme/nsv/intro.htm [ 17 ] Integrated Child development Services ( ICSD ) Scheme, hypertext transfer protocol: //wcd.nic.in/icds.htm

Sunday, September 29, 2019

Globalisation Leads to the Homogenization of Cultures

After World War II, some ambitious leaders advocated the establishment of an effective mechanism to stabilize the world order. One of the ways to maintain the international order is to prevent the disintegration of the world economy (Seitz, 1995, p. 26). Under such a background, the World Trade Organization (WTO) was founded, and then accelerated the development of economic globalization. As there is an inseparable relationship between economy and culture, the more the trend of economic globalization accelerates, the faster the trend of various culture globalization blends (Seitz, 1995, p. 7). Collisions between various cultures may have different consequences. Some scholars think that the long-term results of culture clash might lead to homogenization of cultures, which means people become the same as the dominant culture, such as sharing the same education structures, music, beliefs, and consumer values (Berry, 2008, p. 328). This essay will examine the degree to which globalizatio n assimilates the cultures in different ethnical groups. Culture is constantly changing and developmental, which is influenced by two factors, the natural environment and the social environment.The natural environment with a limited and gradual impact on culture is relatively stable. Social changes are the most direct and frequent factor leading to the changes in trends or conditions. For example, the West Indies, which under the colonial rule of European for a long time, and the religions and values were both effected by dominative groups that means mainstream cultures (Berry, 2008, p. 330). In the time of peace, investing or trading with different countries, touring or studying in various places, can manifest the phenomenon of cultural transmission.With the deepening of economic globalization, these activities become more frequent, different cultures also have a higher and deeper level of mutual contacts. Therefore, a complex situation might be formed, which means there is likely to form four possible consequences, assimilation, integration, separation and marginalization (Berry, 2008, p. 332). One of the possibilities is that the cultural homogenization might be formed owing to the expansion of globalization (Berry, 2008, p. 332).The phenomenon refers to one culture, which is under the penetration of another culture, and then gradually lost its original characteristics to assimilate to the dominant culture. Assimilative culture often seems as an advanced culture or a strong culture; conversely, another culture that is assimilated by the advantaged one might be called a backward culture or a weak culture. An example can be seen in this case, the Soviet Union, which was one of the largest and most powerful nation states, and played a significant role in the movement of globalization.The language, social structure, religious values and economic policies of Estonia, Latvia and Lithuania (which were merged by Soviet Union) were highly influenced and dominated by Russian cultural features. However, nearly 15 years later, the politics, culture and economy of Estonia resurged (Berry, 2008, pp. 332-333). It can be said that globalization leads to the cultural homogenization to some extent. Even if under the rule of the powerful nation, the indigenous culture might still be back after the independence.Another possibility is the integration of different cultures, which is a diversified phenomenon by participating fully into the dominant society that may lead to some shared values and features, while keeping their own distinctive cultures (Berry, 2008, p. 332). For example, McDonald's, which is one of the most successful international food service organizations, has fully realized that it is essential to adapt to the local cultures and obtain understanding and recognition of local consumers to survive in foreign markets (Peng, 2009, p. 19).In particular, McDonald’s in China has promoted special Chicken Nuggets and Chinese rice catering to local dietary habits of consumers. It seems that the taste of the food in McDonald’s is nearly the same around the world, no matter in America, Spain or China. The difference is the various cultures in different countries. McDonald's will introduce new products in some certain areas according to different national consumer taste, preference and legal, religious and local habits of customs (Watson, 2000, p. 125-132). What is more, this phenomenon enriches the connotation of the culture, and increases the diversity of people's consumer choice.Integration of cultures might be the most beneficial to the improvement of countries. The combination of two different societies is likely to create a new culture, which may absorb the advantages of traditional culture and foreign cultures, thus it will bring the innovation and development of societies. The last two possibilities that exist in the process of globalization are called separation and marginalization. Separation means that the non-dominant groups retain their original conditions and refuse to converge with other dominant cultures.Marginalization refers to a process of being outside the dominant society and meanwhile losing their own cultures (Berry, 2008, p. 332). There is an example that comes from a survey about immigrant youth, which was conducted by Berry, Phinney, Sam and Veder in 2006. There is 7997 adolescents (5366 immigrant youth and 2631 national youth respectively) in this survey, the statistics indicated that 975 adolescents showed a strong sense of consciousness to support their own ethnic group by using their own ethnic language fluently, keeping in touch with ethnic peers, and holding a high ethnic identity.These behaviours reflect that the adolescents are not likely to involve into the major society, as they hold an attitude separate to the dominant culture (Berry, 2008, p. 334). On the contrary, the other 973 youth who were in the status of marginalization showed low ethnic identity, low fluency in ethnic language, and fewer contacts with the national peers. However, they endorsed the acculturation attitudes of assimilation, marginalization and separation, which were contradictory.Although these youth tend to join into the dominant society, they lack some necessary abilities to communicate with dominative people (Berry, 2008, p. 335). It might be said that they are lost in the two or more different societies, a certain direction could be effective so that they can feel a sense of presence. In conclusion, according to Berry (2008), globalization may have four possible consequences: assimilation, integration, separation and marginalization. These four outcomes are likely to influence the process of societies between different countries.Social change and development may not lead to the destruction of ethnic or local culture completely. Even when the different cultures integrate, new culture also can retain features of traditional or ethnic culture to a certain degree. But, these changes do not imply the assimilation of cultures influenced by globalization to a great extent. Conversely, as time goes on, cultural differences between various ethnic groups will be gradually reduced, but will not disappear. Therefore, globalization may bring homogenization to cultures to a small extent, but the non-dominative cultures still might be preserved.

Saturday, September 28, 2019

Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words

Gene Analysis - Essay Example Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integra tes in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis. Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base. GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3' Results and discussion: The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence. FIG 1: BLAST results >ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323 Features in this part of subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217 Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104 Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.